blob: 73f85d98a8a79c1765132c791685c0937114e385 [file] [edit]
/* $Id$
*
* Christian Iseli, LICR ITO, Christian.Iseli@licr.org
*
* Copyright (c) 2001-2006 Swiss Institute of Bioinformatics.
* Copyright (C) 1998-2001 Liliana Florea.
*/
/*
* TODO
* - See why tst23 is split
* - See why tst50 has strange alignment
*/
/*
* sim4 - Align a cDNA sequence with a genomic sequence for it.
*
* The basic command syntax is
*
* sim4 [options] dna.seq rna.seq
*
* where dna.seq names a file containing a DNA sequence and rna.seq
* names a file containing one or more RNA sequences.
* The files are to be in FASTA format. Thus a typical sequence file
* might begin:
*
* >BOVHBPP3I Bovine beta-globin psi-3 pseudogene, 5' end.
* GGAGAATAAAGTTTCTGAGTCTAGACACACTGGATCAGCCAATCACAGATGAAGGGCACT
* GAGGAACAGGAGTGCATCTTACATTCCCCCAAACCAATGAACTTGTATTATGCCCTGGGC
*/
#ifdef __sun
#define _XOPEN_SOURCE /* tell sun we want getopt, etc. */
#define _XPG5 /* and we want snprintf */
#endif
#include <sys/types.h>
#include <sys/stat.h>
#include <fcntl.h>
#include <stdlib.h>
#include <stdio.h>
#include <unistd.h>
#include <string.h>
#include <ctype.h>
#include <errno.h>
#include <locale.h>
#include <signal.h>
#include "sim4.h"
#include "align.h"
#include "misc.h"
#include "sim4b1.h"
#if defined(DEBUG) && (DEBUG > 1)
#include <mcheck.h>
#endif
static void init_seq(const char *, seq_p_t);
static int get_next_seq(seq_p_t, unsigned int, int);
static void seq_revcomp_inplace(seq_p_t);
static void print_align_lat(uchar *, uchar *, result_p_t);
static void print_polyA_info(seq_p_t, seq_p_t, collec_p_t, sim4_stats_p_t);
static void print_res(result_p_t, int, seq_p_t, seq_p_t);
static void init_splice_junctions(void);
static void bug_handler(int);
#ifdef DEBUG
static void free_seq(seq_p_t);
#endif
static const char Usage[] =
"%s [options] dna est_db\n\n"
"This is SIBsim4 version 0.14.\n\n"
#ifdef DEBUG
"Debug version\n\n"
#endif
"Available options (default value in braces[]):\n"
" -A <int> output format\n"
" 0: exon endpoints only\n"
" 1: alignment text\n"
" 3: both exon endpoints and alignment text\n"
" 4: both exon endpoints and alignment text with polyA info\n"
" Note that 2 is unimplemented [%d]\n"
" -C <int> MSP score threshold for the second pass [%d]\n"
" -c <int> minimum score cutoff [%d]\n"
" -E <int> cutoff value [%d]\n"
" -f <int> score filter in percent (0 to disable filtering) [%d]\n"
" -g <int> join exons when gap on genomic and RNA have lengths which\n"
" differ at most by this percentage [%d]\n"
" -I <int> window width in which to search for intron splicing [%d]\n"
" -K <int> MSP score threshold for the first pass [%d]\n"
" -L <str> a comma separated list of forward splice-types [%s]\n"
" -M <int> scoring splice sites, evaluate match within M nucleotides [%d]\n"
" -o <int> offset nt positions in dna sequence by this amount [%u]\n"
" -q <int> penalty for a nucleotide mismatch [%d]\n"
" -R <int> direction of search\n"
" 0: search the '+' (direct) strand only\n"
" 1: search the '-' strand only\n"
" 2: search both strands and report the best match\n"
" [%d]\n"
" -r <int> reward for a nucleotide match [%d]\n"
" -W <int> word size [%d]\n"
" -X <int> value for terminating word extensions [%d]\n";
options_t options;
char *argv0;
char dna_seq_head[256];
char rna_seq_head[256];
int
main(int argc, char *argv[])
{
int count;
seq_t seq1, seq2;
hash_env_t he;
collec_t res, rev_res;
#if defined(DEBUG) && (DEBUG > 1)
mcheck(NULL);
mtrace();
#endif
argv0 = argv[0];
#ifndef __XS1B__
if (setlocale(LC_ALL, "POSIX") == NULL)
fprintf(stderr, "%s: Warning: could not set locale to POSIX\n", argv[0]);
signal(SIGSEGV, bug_handler);
#ifndef __MINGW32__
signal(SIGBUS, bug_handler);
#endif
#endif
/* Default options. */
options.C = DEFAULT_C;
options.cutoff = DIST_CUTOFF;
options.gapPct = DEFAULT_GAPPCT;
options.intron_window = 6;
options.K = DEFAULT_K;
options.splice_type_list = "GTAG,GCAG,GTAC,ATAC";
options.nbSplice = 4;
options.scoreSplice_window = 10;
options.mismatchScore = MISMATCH;
options.reverse = 2;
options.matchScore = MATCH;
options.W = DEFAULT_W;
options.X = DEFAULT_X;
options.filterPct = DEFAULT_FILTER;
options.minScore_cutoff = MATCH_CUTOFF;
while (1) {
int c = getopt(argc, argv, "A:C:c:E:f:g:I:K:L:M:o:q:R:r:W:X:");
if (c == -1)
break;
switch (c) {
case 'A':
options.ali_flag = atoi(optarg);
if (options.ali_flag < 0 || options.ali_flag > 4)
fatal("A must be one of 0, 1, 2, 3, or 4.\n");
break;
case 'C': {
int val = atoi(optarg);
if (val < 0)
fatal("Value for option C must be non-negative.\n");
options.C = val;
break;
}
case 'c': {
int val = atoi(optarg);
if (val < 0)
fatal("Value for option c must be non-negative.\n");
options.minScore_cutoff = val;
break;
}
case 'E':
options.cutoff = atoi(optarg);
if (options.cutoff < 3 || options.cutoff > 10)
fatal("Cutoff (E) must be within [3,10].\n");
break;
case 'f':
options.filterPct = atoi(optarg);
if (options.filterPct > 100)
fatal("Filter in percent (f) must be within [0,100].\n");
break;
case 'g':
options.gapPct = atoi(optarg);
break;
case 'I':
options.intron_window = atoi(optarg);
break;
case 'K': {
int val = atoi(optarg);
if (val < 0)
fatal("Value for option K must be non-negative.\n");
options.K = val;
break;
}
case 'L': {
size_t i;
size_t len = strlen(optarg);
options.splice_type_list = optarg;
options.nbSplice = 1;
if (len % 5 != 4)
fatal("Splice types list has illegal length (%zu)\n", len);
for (i = 0; i < len; i++)
if (i % 5 == 4) {
if (options.splice_type_list[i] != ',')
fatal("Comma expected instead of %c at position %zu"
"in splice types list.\n",
options.splice_type_list[i], i);
options.nbSplice += 1;
} else {
if (options.splice_type_list[i] != 'A'
&& options.splice_type_list[i] != 'C'
&& options.splice_type_list[i] != 'G'
&& options.splice_type_list[i] != 'T')
fatal("Expected 'A', 'C', 'G' or 'T' instead of '%c' at"
"position %zu in splice types list.\n",
options.splice_type_list[i], i);
}
break;
}
case 'M': {
int val = atoi(optarg);
if (val < 0)
fatal("Value for option M must be non-negative.\n");
options.scoreSplice_window = val;
break;
}
case 'o':
options.dnaOffset = atoi(optarg);
break;
case 'q':
options.mismatchScore = atoi(optarg);
break;
case 'R':
options.reverse = atoi(optarg);
if (options.reverse < 0 || options.reverse > 2)
fatal("R must be one of 0, 1, or 2.\n");
break;
case 'r':
options.matchScore = atoi(optarg);
break;
case 'W':
options.W = atoi(optarg);
if (options.W < 1 || options.W > 15)
fatal("W must be within [1,15].\n");
break;
case 'X':
options.X = atoi(optarg);
if (options.X < 1)
fatal("X must be positive.\n");
break;
case '?':
break;
default:
fprintf(stderr, "?? getopt returned character code 0%o ??\n", c);
}
}
if (optind + 2 != argc) {
fprintf(stderr, Usage, argv[0], options.ali_flag, options.C,
options.minScore_cutoff, options.cutoff,
options.filterPct, options.gapPct, options.intron_window,
options.K, options.splice_type_list, options.scoreSplice_window,
options.dnaOffset, options.mismatchScore, options.reverse,
options.matchScore, options.W, options.X);
return 1;
}
/* read seq1 */
init_seq(argv[optind], &seq1);
if (get_next_seq(&seq1, options.dnaOffset, 1) != 0)
fatal("Cannot read sequence from %s.\n", argv[optind]);
strncpy(dna_seq_head, seq1.header, 256);
/* read seq2 */
init_seq(argv[optind + 1], &seq2);
if (get_next_seq(&seq2, 0, 0) != 0)
fatal("Cannot read sequence from %s.\n", argv[optind + 1]);
init_encoding();
init_hash_env(&he, options.W, seq1.seq, seq1.len);
init_col(&res, 1);
init_col(&rev_res, 1);
bld_table(&he);
init_splice_junctions();
count = 0;
while (!count || get_next_seq(&seq2, 0, 0) == 0) {
unsigned int curRes;
strncpy(rna_seq_head, seq2.header, 256);
++count;
switch (options.reverse) {
case 0:
SIM4(&he, &seq2, &res);
break;
case 2:
SIM4(&he, &seq2, &res);
case 1:
seq_revcomp_inplace(&seq2);
SIM4(&he, &seq2, &rev_res);
break;
default:
fatal ("Unrecognized request for EST orientation.\n");
}
/* Keep only the best matches, according to filterPct. */
if (options.filterPct > 0) {
unsigned int max_nmatches = 0;
for (curRes = 0; curRes < rev_res.nb; curRes++) {
result_p_t r = rev_res.e.result[curRes];
if (r->st.nmatches > max_nmatches)
max_nmatches = r->st.nmatches;
}
for (curRes = 0; curRes < res.nb; curRes++) {
result_p_t r = res.e.result[curRes];
if (r->st.nmatches > max_nmatches)
max_nmatches = r->st.nmatches;
}
max_nmatches = (max_nmatches * options.filterPct) / 100;
for (curRes = 0; curRes < rev_res.nb; curRes++) {
result_p_t r = rev_res.e.result[curRes];
if (r->st.nmatches < max_nmatches)
r->st.nmatches = 0;
}
for (curRes = 0; curRes < res.nb; curRes++) {
result_p_t r = res.e.result[curRes];
if (r->st.nmatches < max_nmatches)
r->st.nmatches = 0;
}
}
/* Now, print results. */
for (curRes = 0; curRes < rev_res.nb; curRes++)
print_res(rev_res.e.result[curRes], 1, &seq1, &seq2);
rev_res.nb = 0;
if (options.reverse && options.ali_flag)
/* reverse-complement back seq2 for alignment */
seq_revcomp_inplace(&seq2);
for (curRes = 0; curRes < res.nb; curRes++)
print_res(res.e.result[curRes], 0, &seq1, &seq2);
res.nb = 0;
}
#ifdef DEBUG
fprintf(stderr, "DEBUG mode: freeing all memory...\n");
fflush(stdout);
fflush(stderr);
free_hash_env(&he);
free_seq(&seq1);
free_seq(&seq2);
free(options.splice);
free(res.e.elt);
free(rev_res.e.elt);
#endif
return 0;
}
static const unsigned char dna_complement[256] =
" "
" TVGH CD M KN YSA BWXR tvgh cd m kn ysa bwxr "
" "
" ";
/* ................................................................ */
/* @ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~. */
/* ................................................................ */
/* ................................................................ */
static void
init_splice_junctions(void)
{
unsigned int i;
options.splice = (junction_p_t) xmalloc(options.nbSplice
* sizeof(junction_t));
for (i = 0; i < options.nbSplice; i++) {
unsigned int j;
for (j = 0; j < 4; j++) {
uchar c = options.splice_type_list[i * 5 + j];
options.splice[i].fwd[j] = c;
options.splice[i].rev[3 - j] = dna_complement[c];
}
}
#ifdef DEBUG
for (i = 0; i < options.nbSplice; i++)
fprintf(stderr, "Splice[%u]: %.4s %.4s\n",
i, options.splice[i].fwd, options.splice[i].rev);
#endif
}
static void
print_res(result_p_t res, int rev, seq_p_t seq1, seq_p_t seq2)
{
unsigned int i;
if (res->st.nmatches >= options.minScore_cutoff) {
printf("\n%s%s\n", seq1->header, seq2->header);
if (rev)
printf("(complement)\n\n");
switch (options.ali_flag) {
case 0:
print_exons(&res->eCol, res->direction);
break;
case 1:
print_align_lat(seq1->seq, seq2->seq, res);
break;
case 3:
print_exons(&res->eCol, res->direction);
print_align_lat(seq1->seq, seq2->seq, res);
break;
case 4:
print_exons(&res->eCol, res->direction);
print_polyA_info(seq1, seq2, &res->eCol, &res->st);
print_align_lat(seq1->seq, seq2->seq, res);
break;
default:
fatal("Unrecognized option for alignment output.\n");
}
printf("\n");
}
for (i = 0; i < res->eCol.nb; i++)
free(res->eCol.e.elt[i]);
free(res->eCol.e.elt);
if (res->sList)
free_align(res->sList);
free(res);
}
static void
print_polyA_info(seq_p_t s1, seq_p_t s2, collec_p_t eCol,
sim4_stats_p_t st)
{
if (st->polyA_cut) {
unsigned int cnt = 0, cntDna = 0, pos, i, scanLen = 50;
char *pSig, buf[51];
exon_p_t e = eCol->e.exon[eCol->nb - 1];
for (pos = 0; pos < 10 && e->to2 + pos < s2->len; pos++)
if (s2->seq[e->to2 + pos] == 'A')
cnt += 1;
while (e->to2 + pos < s2->len && s2->seq[e->to2 + pos] == 'A') {
pos += 1;
cnt += 1;
}
for (i = 0; i < s1->len && i < pos; i++)
if (s1->seq[e->to1 + i] == 'A')
cntDna += 1;
printf("\nPolyA site %u nt, %u/%u A's %u\n R %.*s %u\n D %*.*s %u\n",
pos, cnt, cntDna, e->to1 + 1 + options.dnaOffset,
pos, s2->seq + e->to2, e->to2 + 1,
pos, i, s1->seq + e->to1, e->to1 + 1 + options.dnaOffset);
if (e->to1 < scanLen)
scanLen = e->to1;
strncpy(buf, (char *) s1->seq + e->to1 - scanLen, scanLen);
buf[scanLen] = 0;
pSig = strstr(buf, "AATAAA");
if (pSig == NULL)
pSig = strstr(buf, "ATTAAA");
if (pSig != NULL)
printf("PolyA signal %u\n",
(unsigned int) (pSig - buf + e->to1 - scanLen + 1
+ options.dnaOffset));
}
if (st->polyT_cut) {
unsigned int cnt = 0, cntDna = 0, pos, i;
char *pSig, buf[51];
exon_p_t e = eCol->e.exon[0];
for (pos = 0; pos < 10 && pos < e->from2 - 1; pos++)
if (s2->seq[e->from2 - 2 - pos] == 'T')
cnt += 1;
while (pos < e->from2 - 1 && s2->seq[e->from2 - 2 - pos] == 'T') {
pos += 1;
cnt += 1;
}
for (i = 0; i < e->from1 - 1 && i < pos; i++)
if (s1->seq[e->from1 - 2 - i] == 'T')
cntDna += 1;
printf("\nPolyA site %u nt, %u/%u A's %u minus strand\n R %.*s %u\n D %*.*s %u\n",
pos, cnt, cntDna, e->from1 - 1 + options.dnaOffset,
pos, s2->seq + (e->from2 - 1 - pos), e->from2 - 1,
pos, i, s1->seq + (e->from1 - 1 - i),
e->from1 - 1 + options.dnaOffset);
strncpy(buf, (char *) s1->seq + e->from1 - 1, 50);
buf[50] = 0;
pSig = strstr(buf, "TTTATT");
if (pSig == NULL)
pSig = strstr(buf, "TTTAAT");
if (pSig != NULL)
printf("PolyA signal %u minus strand\n",
(unsigned int) (pSig - buf + e->from1 + 5 + options.dnaOffset));
}
}
static void
print_align_lat(uchar *seq1, uchar *seq2, result_p_t r)
{
int *S;
edit_script_list_p_t head, aligns;
if (r->sList == NULL)
return;
aligns = r->sList;
while (aligns != NULL) {
head = aligns;
aligns = aligns->next_script;
S = (int *) xmalloc((2 * head->len2 + 1 + 1) * sizeof(int));
S++;
S2A(head->script, S, 0);
Free_script(head->script);
IDISPLAY(seq1 + head->offset1 - 1 - 1, seq2 + head->offset2 - 1 - 1,
head->len1, head->len2, S,
head->offset1, head->offset2, &r->eCol, r->direction);
free(S - 1);
free(head);
}
r->sList = NULL;
}
#ifdef DEBUG
static void
free_buf(read_buf_p_t b)
{
free(b->line);
}
static void
free_seq(seq_p_t sp)
{
free(sp->seq);
free(sp->header);
free_buf(&sp->rb);
if (sp->fName != NULL)
close(sp->fd);
}
#endif
static void
grow_read_buf(read_buf_p_t b)
{
b->lmax += BUF_SIZE;
b->line = xrealloc(b->line, b->lmax * sizeof(char));
}
static char *
shuffle_line(read_buf_p_t b, size_t *cur)
{
if (b->ic == 0 || *cur >= b->ic)
return NULL;
/* Make sure we have enough room in line. */
if (b->lmax <= b->lc + (b->ic - *cur))
grow_read_buf(b);
while (*cur < b->ic && b->in[*cur] != '\n')
b->line[b->lc++] = b->in[(*cur)++];
if (*cur < b->ic) {
/* Ok, we have our string. */
/* Copy the newline. */
b->line[b->lc++] = b->in[(*cur)++];
/* We should be fine, since we read BUF_SIZE -1 at most... */
b->line[b->lc] = 0;
/* Adjust the input buffer. */
if (*cur < b->ic) {
memmove(b->in, b->in + *cur, (b->ic - *cur) * sizeof(char));
b->ic -= *cur;
} else
b->ic = 0;
*cur = 0;
return b->line;
}
/* Go read some more. */
b->ic = 0, *cur = 0;
return NULL;
}
static char *
read_line_buf(read_buf_p_t b, int fd)
{
char *s = NULL;
ssize_t rc;
size_t cur = 0;
b->lc = 0;
if ((s = shuffle_line(b, &cur)) != NULL)
return s;
do {
if ((rc = read(fd, b->in + b->ic, BUF_SIZE - b->ic - 1)) == -1) {
if (errno != EINTR)
fatal("Could not read from %d: %s(%d)\n",
fd, strerror(errno), errno);
} else
b->ic += rc;
s = shuffle_line(b, &cur);
if (s == NULL && rc == 0) {
/* Got to the EOF... */
b->line[b->lc] = 0;
s = b->line;
}
} while (s == NULL);
return s;
}
static void
init_buf(read_buf_p_t b)
{
b->line = xmalloc(BUF_SIZE * sizeof(char));
b->lmax = BUF_SIZE;
b->lc = 0;
b->ic = 0;
}
static void
init_seq(const char *fName, seq_p_t sp)
{
sp->fName = fName;
sp->header = NULL;
sp->seq = NULL;
init_buf(&sp->rb);
if (fName != NULL) {
sp->fd = open(fName, O_RDONLY);
if (sp->fd == -1)
fatal("Could not open file %s: %s(%d)\n",
fName, strerror(errno), errno);
} else
sp->fd = 0;
sp->len = 0;
sp->maxHead = 0;
sp->max = 0;
read_line_buf(&sp->rb, sp->fd);
}
static int
get_next_seq(seq_p_t sp, unsigned int offset, int warnMultiSeq)
{
const int lenStr = 24;
unsigned int headerLen;
char *buf = sp->rb.line;
int res;
while (sp->rb.lc > 0 && buf[0] != '>')
buf = read_line_buf(&sp->rb, sp->fd);
if (sp->rb.lc == 0)
return -1;
/* We have the FASTA header. */
if (sp->rb.lc + lenStr + 1 > sp->maxHead) {
sp->maxHead = sp->rb.lc + lenStr + 1;
sp->header = (char *) xrealloc(sp->header, sp->maxHead * sizeof(char));
}
headerLen = sp->rb.lc;
memcpy(sp->header, buf, (sp->rb.lc + 1) * sizeof(char));
sp->len = 0;
buf = read_line_buf(&sp->rb, sp->fd);
while (sp->rb.lc > 0 && buf[0] != '>') {
unsigned char c;
/* Make sure we have enough room for this additional line. */
if (sp->len + sp->rb.lc + 1 > sp->max) {
sp->max = max(sp->len + sp->rb.lc + 1,
sp->max + 0x40000);
sp->seq = (unsigned char *)
xrealloc(sp->seq, sp->max * sizeof(unsigned char));
}
while ((c = *buf++) != 0) {
if (isupper(c)) {
sp->seq[sp->len++] = c;
} else if (islower(c)) {
sp->seq[sp->len++] = toupper(c);
}
}
buf = read_line_buf(&sp->rb, sp->fd);
}
if (warnMultiSeq && sp->rb.lc > 0)
fprintf(stderr, "\n"
"*** WARNING ***\n"
"*** there appears to be several sequences in the DNA ***\n"
"*** sequence file. Only the first one will be used, ***\n"
"*** which might not be what was intended. ***\n"
"\n");
sp->seq[sp->len] = 0;
buf = strstr(sp->header, "; LEN=");
if (buf) {
char *s = buf + 6;
headerLen -= 6;
while (isdigit(*s)) {
s += 1;
headerLen -= 1;
}
while (*s)
*buf++ = *s++;
}
buf = sp->header + headerLen - 1;
while (iscntrl(*buf) || isspace(*buf))
buf -= 1;
res = snprintf(buf + 1, lenStr, "; LEN=%u\n", sp->len + offset);
if (res < 0 || res >= lenStr)
fatal("Sequence too long: %u\n", sp->len);
return 0;
}
static void
seq_revcomp_inplace(seq_p_t seq)
{
unsigned char *s = seq->seq;
unsigned char *t = seq->seq + seq->len;
unsigned char c;
while (s < t) {
c = dna_complement[*--t];
*t = dna_complement[*s];
*s++ = c;
}
}
static void
bug_handler(int signum)
{
fflush(stdout);
fflush(stderr);
fprintf(stderr, "\nCaught signal %d while processing:\n%.256s\n%.256s\n",
signum, dna_seq_head, rna_seq_head);
abort();
}